Snippet Search

Searching 11,988,706 documents.
Discover how a particular term or phrase is used in scientific literature

Showing 1 to 25 of 218913 matching articles

Results per page:

... Sequences from the KEGG database of  protein 
KEGG orthology-based annotation of the predicted proteome of Acropora digitifera: ZoophyteBase - an open access and searchable database of a coral genome
KEGG orthology-based annotation of the predicted proteome of Acropora digitifera: ZoophyteBase - an open access and searchable database of a coral genome
Dunlap, Walter C; Starcevic, Antonio; Baranasic, Damir; Diminic, Janko; Zucko, Jurica; Gacesa, Ranko; H van Oppen, Madeleine J; Hranueli, Daslav; Cullum, John; Long, Paul F
function were used to construct hidden Markov ...
... ABC transporter, periplasmic hemin-binding  protein 
Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, Marie-Laure; Chauvaux, Sylvie; Dessein, Rodrigue; Laurans, Caroline; Frangeul, Lionel; Lacroix, Céline; Schiavo, Angèle; Dillies, Marie-Agnès; Foulon, Jeannine; Coppée, Jean-Yves; Médigue, Claudine; Carniel, Elisabeth; Simonet, Michel; Marceau, Michaël
HmuT 1.684 (0.016) 2.149 (0.001) YPTB0339 ...
... abundances of many proteins participating in  protein 
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou
synthesis, including ribosomal proteins, ...
... F3 Extracellular solute-binding  protein 
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Gómez-Sagasti, María T.; Becerril, José M.; Epelde, Lur; Alkorta, Itziar; Garbisu, Carlos
3 F: CGCTTGCAGTACCAGATCCC R: ...
... transducing adapter molecule 1 ribosomal  protein 
Unscrambling butterfly oogenesis
Unscrambling butterfly oogenesis
Carter, Jean-Michel; Baker, Simon C; Pink, Ryan; Carter, David RF; Collins, Aiden; Tomlin, Jeremie; Gibbs, Melanie; Breuker, Casper J
LP2 PACG20471 nucleolar GTP-binding ...
... transcripts by interfering with any RNA–  protein 
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
Smith, Carrie A.; Robertson, Dominique; Yates, Bethan; Nielsen, Dahlia M.; Brown, Doug; Dean, Ralph A.; Payne, Gary A.
interactions, including mRNA splicing ...
... TNS order HNS order 1 JHP0952 hypothetical  protein 
Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
Saunders, Nigel J; Boonmee, Prawit; Peden, John F; Jarvis, Stephen A
HP0427 14 3 1355 2 JHP0476 cag pathogenicity ...
... In the endoplasmic reticulum,  protein 
Effects of Protein Quality Control Machinery on Protein Homeostasis
Effects of Protein Quality Control Machinery on Protein Homeostasis
Sandefur, Conner I.; Schnell, Santiago
production occurs through a complex set of ...
... Results We have investigated how well the  protein 
Microarray analysis of orthologous genes: conservation of the translational machinery across species at the sequence and expression level
Microarray analysis of orthologous genes: conservation of the translational machinery across species at the sequence and expression level
Jiménez, Jose L; Mitchell, Michael P; Sgouros, John G
subcellular localization and functional ...
... proteins containing sequence and/or  protein 
Genome-wide subcellular localization of putative outer membrane and extracellular proteins in Leptospira interrogans serovar Lai genome using bioinformatics approaches
Genome-wide subcellular localization of putative outer membrane and extracellular proteins in Leptospira interrogans serovar Lai genome using bioinformatics approaches
Viratyosin, Wasna; Ingsriswang, Supawadee; Pacharawongsakda, Eakasit; Palittapongarnpim, Prasit
folding structures similar to those of known ...
... here a first glimpse to this developing  protein 
A Glimpse into the Proteome of Phototrophic Bacterium Rhodobacter capsulatus
A Glimpse into the Proteome of Phototrophic Bacterium Rhodobacter capsulatus
Onder, Ozlem; Aygun-Sunar, Semra; Selamoglu, Nur; Daldal, Fevzi
identification dataset. ...
... by extracting functional information from  protein 
Bridging protein local structures and protein functions
Bridging protein local structures and protein functions
Liu, Zhi-Ping; Wu, Ling-Yun; Wang, Yong; Zhang, Xiang-Sun; Chen, Luonan
sequences, structures and interactions. ...
... In agreement with physiological and  protein 
Comparison of long-term up-regulated genes during induction of freezing tolerance by cold and ABA in bromegrass cell cultures revealed by microarray analyses
Comparison of long-term up-regulated genes during induction of freezing tolerance by cold and ABA in bromegrass cell cultures revealed by microarray analyses
Nakamura, Toshihide; Yazaki, Junshi; Kishimoto, Naoki; Kikuchi, Shoshi; Robertson, Albert J.; Gusta, Lawrence V.; Ishikawa, Masaya
studies, these two cold hardiness induction ...
... As in other coronaviruses, the nucleocapsid  protein 
The Nucleocapsid Protein of the SARS Coronavirus: Structure, Function and Therapeutic Potential
The Nucleocapsid Protein of the SARS Coronavirus: Structure, Function and Therapeutic Potential
Surjit, Milan; Lal, Sunil K.
is one of the core components of the SARS ...
... PCR targeting the 4b gene that encodes a core  protein 
Genomic characterization of two novel pathogenic avipoxviruses isolated from pacific shearwaters (Ardenna spp.)
Genomic characterization of two novel pathogenic avipoxviruses isolated from pacific shearwaters (Ardenna spp.)
Sarker, Subir; Das, Shubhagata; Lavers, Jennifer L.; Hutton, Ian; Helbig, Karla; Imbery, Jacob; Upton, Chris; Raidal, Shane R.
of ChPV, however, there were no evidence of ...
... techniques became widely available for  protein 
Proteomics of Foodborne Bacterial Pathogens
Proteomics of Foodborne Bacterial Pathogens
Fagerquist, Clifton K.
identification, proteins were identified by ...
... there was a corresponding difference in  protein 
The CJIE1 prophage of Campylobacter jejuni affects protein expression in growth media with and without bile salts
The CJIE1 prophage of Campylobacter jejuni affects protein expression in growth media with and without bile salts
Clark, Clifford G; Chong, Patrick M; McCorrister, Stuart J; Simon, Philippe; Walker, Matthew; Lee, David M; Nguy, Kimberly; Cheng, Keding; Gilmour, Matthew W; Westmacott, Garrett R
expression levels. ...
... owing largely to the difficulties in membrane  protein 
Approaches for Preparation and Biophysical Characterization of Transmembrane β-Barrels
Approaches for Preparation and Biophysical Characterization of Transmembrane β-Barrels
Iyer, Bharat Ramasubramanian; Gupta, Ankit; Mahalakshmi, Radhakrishnan
purification and amenable methods for their ...
... and sustainable biomass for the production of  protein 
The protein content of seaweeds: a universal nitrogen-to-protein conversion factor of five
The protein content of seaweeds: a universal nitrogen-to-protein conversion factor of five
Angell, Alex R.; Mata, Leonardo; Nys, Rocky; Paul, Nicholas A.
has resulted in a renewed interest in the ...
... demonstrate that the soluble mannose-binding  protein 
GLYCO 22 XXII International Symposium on Glycoconjugates
GLYCO 22 XXII International Symposium on Glycoconjugates
(MBP) (alternatively called the ...
... fertilizer or soil compost due to their high  protein 
Utilization of Oilseed Cakes for Human Nutrition and Health Benefits
Utilization of Oilseed Cakes for Human Nutrition and Health Benefits
Teh, Sue-Siang; Bekhit, Alaa El-Din A.
, carbohydrate, mineral and nitrogen ...
... study formed a monophyletic group in the RpoB  protein 
Phylum XIII. Firmicutes Gibbons and Murray 1978, 5 (Firmacutes [sic] Gibbons and Murray 1978, 5)
Phylum XIII. Firmicutes Gibbons and Murray 1978, 5 (Firmacutes [sic] Gibbons and Murray 1978, 5)
Schleifer, Karl-Heinz
tree well-separated from the Mollicutes. ...
... analyses of phospholabeled  protein 
A Ser/Thr protein kinase phosphorylates MA-ACS1 (Musa acuminata 1-aminocyclopropane-1-carboxylic acid synthase 1) during banana fruit ripening
A Ser/Thr protein kinase phosphorylates MA-ACS1 (Musa acuminata 1-aminocyclopropane-1-carboxylic acid synthase 1) during banana fruit ripening
Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N.
extracts from banana fruit using ...
... was discovered in 1978 as a calcium-binding  protein 
Regucalcin and cell regulation: role as a suppressor protein in signal transduction
Regucalcin and cell regulation: role as a suppressor protein in signal transduction
Yamaguchi, Masayoshi
that does not contain EF-hand motif of ...
... indicate regulation by a catabolite control  protein 
Global transcriptome response in Lactobacillus sakei during growth on ribose
Global transcriptome response in Lactobacillus sakei during growth on ribose
McLeod, Anette; Snipen, Lars; Naterstad, Kristine; Axelsson, Lars
A (CcpA)-mediated carbon catabolite ...