Snippet Search

Searching 12,336,397 documents.
Discover how a particular term or phrase is used in scientific literature

Showing 1 to 25 of 91729 matching articles

Results per page:

... abundances of many proteins participating in  protein 
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou
synthesis, including ribosomal proteins, ...
... changes in lipid (Uemura et al. 1995) and  protein 
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Oono, Youko; Seki, Motoaki; Satou, Masakazu; Iida, Kei; Akiyama, Kenji; Sakurai, Tetsuya; Fujita, Miki; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo
(Kawamura and Uemura 2003) composition of ...
... F3 Extracellular solute-binding  protein 
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Gómez-Sagasti, María T.; Becerril, José M.; Epelde, Lur; Alkorta, Itziar; Garbisu, Carlos
3 F: CGCTTGCAGTACCAGATCCC R: ...
... transcripts by interfering with any RNA–  protein 
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
Smith, Carrie A.; Robertson, Dominique; Yates, Bethan; Nielsen, Dahlia M.; Brown, Doug; Dean, Ralph A.; Payne, Gary A.
interactions, including mRNA splicing ...
... calcium oxalate monohydrate (COM) crystal-  protein 
Characterizations of PMCA2-interacting complex and its role as a calcium oxalate crystal-binding protein
Characterizations of PMCA2-interacting complex and its role as a calcium oxalate crystal-binding protein
Vinaiphat, Arada; Thongboonkerd, Visith
binding, crystal-cell adhesion, and crystal ...
... As in other coronaviruses, the nucleocapsid  protein 
The Nucleocapsid Protein of the SARS Coronavirus: Structure, Function and Therapeutic Potential
The Nucleocapsid Protein of the SARS Coronavirus: Structure, Function and Therapeutic Potential
Surjit, Milan; Lal, Sunil K.
is one of the core components of the SARS ...
... owing largely to the difficulties in membrane  protein 
Approaches for Preparation and Biophysical Characterization of Transmembrane β-Barrels
Approaches for Preparation and Biophysical Characterization of Transmembrane β-Barrels
Iyer, Bharat Ramasubramanian; Gupta, Ankit; Mahalakshmi, Radhakrishnan
purification and amenable methods for their ...
... a number of biological products that include  protein 
Comparative pan genome analysis of oral Prevotella species implicated in periodontitis
Comparative pan genome analysis of oral Prevotella species implicated in periodontitis
Ibrahim, Maziya; Subramanian, Ahalyaa; Anishetty, Sharmila
toxins, lipopolysaccharide (endotoxin), ...
... as heat-responsive that were implicated in  protein 
Comparative transcriptome profiling of upland (VS16) and lowland (AP13) ecotypes of switchgrass
Comparative transcriptome profiling of upland (VS16) and lowland (AP13) ecotypes of switchgrass
Ayyappan, Vasudevan; Saha, Malay C.; Thimmapuram, Jyothi; Sripathi, Venkateswara R.; Bhide, Ketaki P.; Fiedler, Elizabeth; Hayford, Rita K.; Kalavacharla, Venu (Kal)
refolding (Li et al. 2013). The role of ...
... wheat cultivar, Rosella. Wheat germ  protein 
A proteomic approach to the identification and characterisation of protein composition in wheat germ
A proteomic approach to the identification and characterisation of protein composition in wheat germ
Mak, Yunxian; Skylas, Daniel J.; Willows, Robert; Connolly, Angela; Cordwell, Stuart J.; Wrigley, Colin W.; Sharp, Peter J.; Copeland, Les
extracts were fractionated by two-dimensional ...
... acid sequences from the GenBank non-redundant  protein 
Genes expressed during the development and ripening of watermelon fruit
Genes expressed during the development and ripening of watermelon fruit
Levi, A.; Davis, A.; Hernandez, A.; Wechter, P.; Thimmapuram, J.; Trebitsh, T.; Tadmor, Y.; Katzir, N.; Portnoy, V.; King, S.
database. ...
... to the surface through a process known as  protein 
Protein Adsorption to Biomaterials
Protein Adsorption to Biomaterials
Schmidt, David Richard; Waldeck, Heather; Kao, Weiyuan John
adsorption. ...
... Shelterin is a six-  protein 
Molecular basis and quantitative assessment of TRF1 and TRF2 protein interactions with TIN2 and Apollo peptides
Molecular basis and quantitative assessment of TRF1 and TRF2 protein interactions with TIN2 and Apollo peptides
Kalathiya, Umesh; Padariya, Monikaben; Baginski, Maciej
complex (TRF1, TRF2, POT1, RAP1, TIN2, and ...
... important parameter. This review evaluates  protein 
Quantitative proteomics: assessing the spectrum of in-gel protein detection methods
Quantitative proteomics: assessing the spectrum of in-gel protein detection methods
Gauci, Victoria J.; Wright, Elise P.; Coorssen, Jens R.
detection methods in terms of their ...
... response to extracellular signals. Currently,  protein 
Technology of Wheat Cell-Free-Based Protein Array for Biochemical Analyses of Protein Kinases and Ubiquitin E3 Ligases
Technology of Wheat Cell-Free-Based Protein Array for Biochemical Analyses of Protein Kinases and Ubiquitin E3 Ligases
Takahashi, Hirotaka; Nemoto, Keiichirou; Abdelaziz, Ramadan; Uematsu, Atsushi; Sawasaki, Tatsuya
phosphorylation is considered as an important ...
... microRNAs: New Mechanisms of Non-Autonomous  Protein 
Program-Abstracts
Program-Abstracts
Functions and Post-Transcriptional Control ...
... in Rm1021, which results in truncation of the  protein 
Global transcriptional analysis of the phosphate starvation response in Sinorhizobium meliloti strains 1021 and 2011
Global transcriptional analysis of the phosphate starvation response in Sinorhizobium meliloti strains 1021 and 2011
Krol, E.; Becker, A.
product. ...
... their helper viruses by virtue of encoding a  protein 
Abstracts of the 8th international geminivirus symposium and the 6th international ssDNA comparative virology workshop, 7–10th November 2016, New Delhi
Abstracts of the 8th international geminivirus symposium and the 6th international ssDNA comparative virology workshop, 7–10th November 2016, New Delhi
Roy, Anirban
which overcomes gene silencing. ...
... consist of a hydrophobic integral membrane  protein 
Genome scale identification, structural analysis, and classification of periplasmic binding proteins from Mycobacterium tuberculosis
Genome scale identification, structural analysis, and classification of periplasmic binding proteins from Mycobacterium tuberculosis
Sandhu, Padmani; Kumari, Monika; Naini, Kamal; Akhter, Yusuf
, hydrophilic peripheral membrane ...
... temperature range (DSC) and the heats of  protein 
Microcalorimetry of Proteins and Their Complexes
Microcalorimetry of Proteins and Their Complexes
Privalov, Peter L.
reactions at fixed temperatures (ITC) are ...
...  Protein 
Molecular Simulation of Protein-Surface Interactions
Molecular Simulation of Protein-Surface Interactions
Latour, Robert A.
-surface interactions are fundamentally ...
... faced with the task of providing a library of  protein 
Target Selection for Structural Genomics: An Overview
Target Selection for Structural Genomics: An Overview
Marsden, Russell L.; Orengo, Christine A.
structures that represent the biological ...
... under redox conditions to obtain a bioactive  protein 
Matrix-Assisted Refolding, Purification and Activity Assessment Using a ‘Form Invariant’ Assay for Matrix Metalloproteinase 2 (MMP2)
Matrix-Assisted Refolding, Purification and Activity Assessment Using a ‘Form Invariant’ Assay for Matrix Metalloproteinase 2 (MMP2)
Singh, Krishna Kumar; Jain, Ruchi; Ramanan, Harini; Saini, Deepak Kumar
. ...
... were queried against the non-redundant  protein 
Early developmental and stress responsive ESTs from mungbean, Vigna radiata (L.) Wilczek, seedlings
Early developmental and stress responsive ESTs from mungbean, Vigna radiata (L.) Wilczek, seedlings
Chen, Li-Ru; Markhart, Albert H.; Shanmugasundaram, S.; Lin, Tsai-Yun
database using the BLASTX program of the ...
... Summary HaloTag™ is a  protein 
Methods for Detection of Protein–Proteinnl and Protein–DNA Interactions Using HaloTag ™
Methods for Detection of Protein–Proteinnl and Protein–DNA Interactions Using HaloTag ™
Urh, Marjeta; Hartzell, Danette; Mendez, Jacqui; Klaubert, Dieter H.; Wood, Keith
fusion tag which was genetically engineered ...