Snippet Search

Searching 12,329,257 documents.
Discover how a particular term or phrase is used in scientific literature

Showing 1 to 25 of 121805 matching articles

Results per page:

... abundances of many proteins participating in  protein 
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou
synthesis, including ribosomal proteins, ...
... changes in lipid (Uemura et al. 1995) and  protein 
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Oono, Youko; Seki, Motoaki; Satou, Masakazu; Iida, Kei; Akiyama, Kenji; Sakurai, Tetsuya; Fujita, Miki; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo
(Kawamura and Uemura 2003) composition of ...
... F3 Extracellular solute-binding  protein 
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Gómez-Sagasti, María T.; Becerril, José M.; Epelde, Lur; Alkorta, Itziar; Garbisu, Carlos
3 F: CGCTTGCAGTACCAGATCCC R: ...
... Multiparameter Proteomics Using  Protein 
Personalized Diagnosis and Therapy
Personalized Diagnosis and Therapy
Müller, Günter
Chips Purpose and Rationale Patient-tailored ...
... transcripts by interfering with any RNA–  protein 
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
Smith, Carrie A.; Robertson, Dominique; Yates, Bethan; Nielsen, Dahlia M.; Brown, Doug; Dean, Ralph A.; Payne, Gary A.
interactions, including mRNA splicing ...
... splicing of many target genes. This  protein 
ICIEM Abstracts
ICIEM Abstracts
is a component of the spliceosome and has ...
... an ubiquitous expression of the Agouti  protein 
Antidiabetic Activity
Antidiabetic Activity
Vogel, Hans Gerhard
which represents an antagonist of the ...
... here a first glimpse to this developing  protein 
A Glimpse into the Proteome of Phototrophic Bacterium Rhodobacter capsulatus
A Glimpse into the Proteome of Phototrophic Bacterium Rhodobacter capsulatus
Onder, Ozlem; Aygun-Sunar, Semra; Selamoglu, Nur; Daldal, Fevzi
identification dataset. ...
... by extracting functional information from  protein 
Bridging protein local structures and protein functions
Bridging protein local structures and protein functions
Liu, Zhi-Ping; Wu, Ling-Yun; Wang, Yong; Zhang, Xiang-Sun; Chen, Luonan
sequences, structures and interactions. ...
... calcium oxalate monohydrate (COM) crystal-  protein 
Characterizations of PMCA2-interacting complex and its role as a calcium oxalate crystal-binding protein
Characterizations of PMCA2-interacting complex and its role as a calcium oxalate crystal-binding protein
Vinaiphat, Arada; Thongboonkerd, Visith
binding, crystal-cell adhesion, and crystal ...
... a number of biological products that include  protein 
Comparative pan genome analysis of oral Prevotella species implicated in periodontitis
Comparative pan genome analysis of oral Prevotella species implicated in periodontitis
Ibrahim, Maziya; Subramanian, Ahalyaa; Anishetty, Sharmila
toxins, lipopolysaccharide (endotoxin), ...
... demonstrate that the soluble mannose-binding  protein 
GLYCO 22 XXII International Symposium on Glycoconjugates
GLYCO 22 XXII International Symposium on Glycoconjugates
(MBP) (alternatively called the ...
... was discovered in 1978 as a calcium-binding  protein 
Regucalcin and cell regulation: role as a suppressor protein in signal transduction
Regucalcin and cell regulation: role as a suppressor protein in signal transduction
Yamaguchi, Masayoshi
that does not contain EF-hand motif of ...
... The other was on a complement regulatory  protein 
GLYCO 23 XXIII International Symposium on Glycoconjugates
GLYCO 23 XXIII International Symposium on Glycoconjugates
, decay accelerating factor (DAF). ...
... wheat cultivar, Rosella. Wheat germ  protein 
A proteomic approach to the identification and characterisation of protein composition in wheat germ
A proteomic approach to the identification and characterisation of protein composition in wheat germ
Mak, Yunxian; Skylas, Daniel J.; Willows, Robert; Connolly, Angela; Cordwell, Stuart J.; Wrigley, Colin W.; Sharp, Peter J.; Copeland, Les
extracts were fractionated by two-dimensional ...
... belief that the unique function of a  protein 
Intrinsically Disordered Proteins
Intrinsically Disordered Proteins
Uversky, Vladimir N.
is determined by its unique structure, which, ...
... determinants or B-cell epitopes) for a given  protein 
Antibody-protein interactions: benchmark datasets and prediction tools evaluation
Antibody-protein interactions: benchmark datasets and prediction tools evaluation
Ponomarenko, Julia V; Bourne, Philip E
is a precursor to new vaccine design and ...
... used to degrade the starch matrix, to release  protein 
Rice folate enhancement through metabolic engineering has an impact on rice seed metabolism, but does not affect the expression of the endogenous folate biosynthesis genes
Rice folate enhancement through metabolic engineering has an impact on rice seed metabolism, but does not affect the expression of the endogenous folate biosynthesis genes
Blancquaert, Dieter; Van Daele, Jeroen; Storozhenko, Sergei; Stove, Christophe; Lambert, Willy; Van Der Straeten, Dominique
-bound folates and to deconjugate ...
... commonly used techniques to determine DNA–  protein 
DNA–protein interactions: methods for detection and analysis
DNA–protein interactions: methods for detection and analysis
Dey, Bipasha; Thukral, Sameer; Krishnan, Shruti; Chakrobarty, Mainak; Gupta, Sahil; Manghani, Chanchal; Rani, Vibha
interactions. ...
... to obtain peptides, small proteins, or  protein 
Expressed Protein Ligation for Protein Semisynthesis and Engineering
Expressed Protein Ligation for Protein Semisynthesis and Engineering
Machova, Zuzana; Beck-Sickinger, Annette G.
domains (up to approx 150 residues), larger ...
... Shelterin is a six-  protein 
Molecular basis and quantitative assessment of TRF1 and TRF2 protein interactions with TIN2 and Apollo peptides
Molecular basis and quantitative assessment of TRF1 and TRF2 protein interactions with TIN2 and Apollo peptides
Kalathiya, Umesh; Padariya, Monikaben; Baginski, Maciej
complex (TRF1, TRF2, POT1, RAP1, TIN2, and ...
... important parameter. This review evaluates  protein 
Quantitative proteomics: assessing the spectrum of in-gel protein detection methods
Quantitative proteomics: assessing the spectrum of in-gel protein detection methods
Gauci, Victoria J.; Wright, Elise P.; Coorssen, Jens R.
detection methods in terms of their ...
... is incorporated covalently into  protein 
N-Homocysteinyl-Proteins
N-Homocysteinyl-Proteins
Jakubowski, Hieronim
[73, 78]. ...
... The study of the  protein 
A simple recipe for the non-expert bioinformaticist for building experimentally-testable hypotheses for proteins with no known homologs
A simple recipe for the non-expert bioinformaticist for building experimentally-testable hypotheses for proteins with no known homologs
Zawaira, Alexander; Shibayama, Youtaro
– ...
... Amyloids are filamentous  protein 
Amyloid peptides and proteins in review
Amyloid peptides and proteins in review
Harrison, R. S.; Sharpe, P. C.; Singh, Y.; Fairlie, D. P.
deposits ranging in size from nanometres to ...