Snippet Search

Searching 11,456,268 documents.
Discover how a particular term or phrase is used in scientific literature

Showing 1 to 25 of 595877 matching articles

Results per page:

... domain of transmembrane receptors; (2)  protein 
Guanosine Triphosphatases and Their Regulators
Guanosine Triphosphatases and Their Regulators
Thiriet, Marc
synthesis at the ribosome (Vol. 1 – Chap. 5 ...
... because they lack the gene encoding the X  protein 
Viruses with a Double-Stranded DNA Genome
Viruses with a Double-Stranded DNA Genome
Modrow, Susanne; Dietrich, Falke; Truyen, Uwe; Schätzl, Hermann
, a non-structural ...
... Numerous  protein 
Cytoplasmic Protein Serine/Threonine Kinases
Cytoplasmic Protein Serine/Threonine Kinases
Thiriet, Marc
serine/threonine kinases operate in signal ...
... Sect. 10.5); (3) some coregulators, such as (  protein 
Other Major Types of Signaling Mediators
Other Major Types of Signaling Mediators
Thiriet, Marc
kinase) A-kinase-anchoring proteins (AKAP; ...
... abundances of many proteins participating in  protein 
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou
synthesis, including ribosomal proteins, ...
... Mitogen-activated  protein 
Mitogen-Activated Protein Kinase Module
Mitogen-Activated Protein Kinase Module
Thiriet, Marc
kinase (MAPK) modules are commonly used to ...
...  Protein 
Cytosolic Protein Phosphatases
Cytosolic Protein Phosphatases
Thiriet, Marc
phosphorylation is a common, reversible, ...
... food researchers to explore alternative  protein 
Protein Modification During Ingredient Preparation and Food Processing: Approaches to Improve Food Processability and Nutrition
Protein Modification During Ingredient Preparation and Food Processing: Approaches to Improve Food Processability and Nutrition
Sun-Waterhouse, Dongxiao; Zhao, Mouming; Waterhouse, Geoffrey I. N.
sources and sustainable and optimized use of ...
... contain large quantities of the precursor  protein 
Viruses with Single-Stranded, Positive-Sense RNA Genomes
Viruses with Single-Stranded, Positive-Sense RNA Genomes
Modrow, Susanne; Falke, Dietrich; Truyen, Uwe; Schätzl, Hermann
. ...
... changes in lipid (Uemura et al. 1995) and  protein 
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Oono, Youko; Seki, Motoaki; Satou, Masakazu; Iida, Kei; Akiyama, Kenji; Sakurai, Tetsuya; Fujita, Miki; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo
(Kawamura and Uemura 2003) composition of ...
... F3 Extracellular solute-binding  protein 
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Gómez-Sagasti, María T.; Becerril, José M.; Epelde, Lur; Alkorta, Itziar; Garbisu, Carlos
3 F: CGCTTGCAGTACCAGATCCC R: ...
... Multiparameter Proteomics Using  Protein 
Personalized Diagnosis and Therapy
Personalized Diagnosis and Therapy
Müller, Günter
Chips Purpose and Rationale Patient-tailored ...
... solubilization processes for isolating muscle  protein 
The Acid and Alkaline Solubilization Process for the Isolation of Muscle Proteins: State of the Art
The Acid and Alkaline Solubilization Process for the Isolation of Muscle Proteins: State of the Art
Nolsøe, Helgi; Undeland, Ingrid
from ground fish raw materials are ...
... attaining and maintaining muscle mass. From  protein 
Building Muscle Mass: Physiology, Nutrition, and Supplementation
Building Muscle Mass: Physiology, Nutrition, and Supplementation
Levers, Kyle; Vargo, Kelley
to creatine, arginine to human growth ...
... transcripts by interfering with any RNA–  protein 
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
Smith, Carrie A.; Robertson, Dominique; Yates, Bethan; Nielsen, Dahlia M.; Brown, Doug; Dean, Ralph A.; Payne, Gary A.
interactions, including mRNA splicing ...
... Multiparameter Proteomics Using  Protein 
Personalized Diagnosis and Therapy
Personalized Diagnosis and Therapy
Müller, Günter
Chips Purpose and Rationale Patient-tailored ...
... splicing of many target genes. This  protein 
ICIEM Abstracts
ICIEM Abstracts
is a component of the spliceosome and has ...
... organisms (1,2). These highly regulated  protein 
Protein–Protein Interactions
Protein–Protein Interactions
Park, Hae Ryoun; Cockrell, Lisa Montoya; Du, Yuhong; Kasinski, Andrea; Havel, Jonathan; Zhao, Jing; Reyes-Turcu, Francisca; Wilkinson, Keith D.; Fu, Haian
– ...
... In the endoplasmic reticulum,  protein 
Effects of Protein Quality Control Machinery on Protein Homeostasis
Effects of Protein Quality Control Machinery on Protein Homeostasis
Sandefur, Conner I.; Schnell, Santiago
production occurs through a complex set of ...
... an ubiquitous expression of the Agouti  protein 
Antidiabetic Activity
Antidiabetic Activity
Vogel, Hans Gerhard
which represents an antagonist of the ...
... 32 mutations in the amyloid beta precursor  protein 
Pharmacogenomics of Alzheimer’s Disease: Novel Therapeutic Strategies for Drug Development
Pharmacogenomics of Alzheimer’s Disease: Novel Therapeutic Strategies for Drug Development
Cacabelos, Ramón; Cacabelos, Pablo; Torrellas, Clara; Tellado, Iván; Carril, Juan C.
(APP) gene (21q21) (AD1); 165 mutations in ...
... Nashville, TN A detailed understanding of  protein 
Abstract
Abstract
expression in breast cancer will require the ...
... lead to the discovery of a group of 14 G-  Protein 
C
C
Davis, Justin R.; Giles, Andrew C.; Rankin, Catharine H.; Bell, Jonathan; Kimura, Hiroshi; Uemura, Tadashi; Kidokoro, Yoshi; Lemieux, Mado; Koninck, Paul De; Carbone, Emilio; Senatore, Adriano; Spafford, J. David; Dowie, Megan J.; Grimsey*, Natasha L.; Glass, Michelle; Gillis, Kevin D.; Hunter, Peter; Budgell, Brian; Roy, Arijit; Wilson, Richard J. A.; Hikosaka, Okihide; Esfeld, Michael; Harbecke, Jens; Mitsuhashi, Takayuki; Takahashi, Takao; Kageyama, Ryoichiro; Ohsawa, Ryosuke; Ohtsuka, Toshiyuki; Lalley, Peter M.; Nitabach, Michael N.; Paton, Julian F. R.; Waitzman, David M.; Nattie, Eugene; Li, Aihua; Tsunoda, Ikuo; Kobayashi-Warren, Mikako; Libbey, Jane E.; Fujinami, Robert S.; Kulkarni, Amod P.; Kellaway, Laurie A.; Kotwal, Girish J.; Morgen, Katrin E.; Ciufolini, Maria Grazia; Nicoletti, Loredana; Davis, Randall L.; Hofer, Markus J.; Campbell, Iain L.; Jensen, Troels S.; Finnerup, Nanna B.; Straub, Volko A.; Benarroch, Eduardo E.; Bronstein, Adolfo M.; Nissant, Antoine; Bloedel, James R.; Bracha, Vlastislav; Highstein, Stephen M.; Scudder, Charles A.; Kachur, Torah M.; Pilgrim, Dave B.; André, Holley; Mindell, Joseph A.; Maduke, Merritt; Ormond, John; Woodin, Melanie A.; Datta, Subimal; Eisenstat, David D.; Severinsen, Kaare; Jakobsen, Johannes; Merrow, Martha; Roenneberg, Till; Schall, Jeffrey D.; Vogt, Brent A.; Morecraft, Robert J.; Tischkau, Shelley; Gerkema, Menno P.; Buijs, Ruud M.; Lewy, Alfred J.; Hazlerigg, David; Yamamoto, Takashi; Epstein, Marcelo; Tischkau, Shelley; Ripperger, Jürgen A.; Albrecht, Urs; Kramer, Achim; Albrecht, Urs; Ripperger, Jürgen A.; Ruggero, Mario A.; Shannon, Robert V.; Malmierca, Manuel S.; Smith, Philip H.; Sodian, Beate; Nieder, Andreas; Mast, Fred W.; Godde, Ben; Hansen, Thorsten; Gegenfurtner, Karl R.; Faure, Philippe; Allan, Douglas W.; Asoh, Hideki; Jänig, Wilfrid; Rybak, Ilya A.; Smith, Jeffrey C.; Karniel, Amir; Sanguineti, Vittorio; Mansergh, Fiona; R.Wolpaw, Jonathan; McFarland, Dennis J.; Yamamoto, Takashi; Mareschal, Denis; Althaus, Nadja; Epstein, Marcelo; Lee, Tai Sing; Epstein, Marcelo; Epstein, Marcelo; Cleland, Thomas A.; Goodwin, Graham C.; Feuer, Arie; Latash, Mark L.; Marín, Oscar; Lucassen, Paul J.; Boekhoorn, Karin; Francis, Fiona; Groenewegen, Henk J.; Ogawa, Hisashi; Macefield, Vaughan G; Birznieks, Ingvars; Biel, Martin
Coupled Receptor subunits that are ...
... here a first glimpse to this developing  protein 
A Glimpse into the Proteome of Phototrophic Bacterium Rhodobacter capsulatus
A Glimpse into the Proteome of Phototrophic Bacterium Rhodobacter capsulatus
Onder, Ozlem; Aygun-Sunar, Semra; Selamoglu, Nur; Daldal, Fevzi
identification dataset. ...
... by extracting functional information from  protein 
Bridging protein local structures and protein functions
Bridging protein local structures and protein functions
Liu, Zhi-Ping; Wu, Ling-Yun; Wang, Yong; Zhang, Xiang-Sun; Chen, Luonan
sequences, structures and interactions. ...