Snippet Search

Searching 12,189,325 documents.
Discover how a particular term or phrase is used in scientific literature

Showing 1 to 25 of 549749 matching articles

Results per page:

... Sequences from the KEGG database of  protein 
KEGG orthology-based annotation of the predicted proteome of Acropora digitifera: ZoophyteBase - an open access and searchable database of a coral genome
KEGG orthology-based annotation of the predicted proteome of Acropora digitifera: ZoophyteBase - an open access and searchable database of a coral genome
Dunlap, Walter C; Starcevic, Antonio; Baranasic, Damir; Diminic, Janko; Zucko, Jurica; Gacesa, Ranko; H van Oppen, Madeleine J; Hranueli, Daslav; Cullum, John; Long, Paul F
function were used to construct hidden Markov ...
... ABC transporter, periplasmic hemin-binding  protein 
Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, Marie-Laure; Chauvaux, Sylvie; Dessein, Rodrigue; Laurans, Caroline; Frangeul, Lionel; Lacroix, Céline; Schiavo, Angèle; Dillies, Marie-Agnès; Foulon, Jeannine; Coppée, Jean-Yves; Médigue, Claudine; Carniel, Elisabeth; Simonet, Michel; Marceau, Michaël
HmuT 1.684 (0.016) 2.149 (0.001) YPTB0339 ...
... abundances of many proteins participating in  protein 
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou
synthesis, including ribosomal proteins, ...
... and critical review related to the intake of  protein 
International Society of Sports Nutrition Position Stand: protein and exercise
International Society of Sports Nutrition Position Stand: protein and exercise
Jäger, Ralf; Kerksick, Chad M.; Campbell, Bill I.; Cribb, Paul J.; Wells, Shawn D.; Skwiat, Tim M.; Purpura, Martin; Ziegenfuss, Tim N.; Ferrando, Arny A.; Arent, Shawn M.; Smith-Ryan, Abbie E.; Stout, Jeffrey R.; Arciero, Paul J.; Ormsbee, Michael J.; Taylor, Lem W.; Wilborn, Colin D.; Kalman, Doug S.; Kreider, Richard B.; Willoughby, Darryn S.; Hoffman, Jay R.; Krzykowski, Jamie L.; Antonio, Jose
for healthy, exercising individuals. ...
... food researchers to explore alternative  protein 
Protein Modification During Ingredient Preparation and Food Processing: Approaches to Improve Food Processability and Nutrition
Protein Modification During Ingredient Preparation and Food Processing: Approaches to Improve Food Processability and Nutrition
Sun-Waterhouse, Dongxiao; Zhao, Mouming; Waterhouse, Geoffrey I. N.
sources and sustainable and optimized use of ...
... an explosion of research papers concerning  protein 
Contemporary Issues in Protein Requirements and Consumption for Resistance Trained Athletes
Contemporary Issues in Protein Requirements and Consumption for Resistance Trained Athletes
Wilson, Jacob; Wilson, Gabriel J
consumption has been published. ...
... changes in lipid (Uemura et al. 1995) and  protein 
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Oono, Youko; Seki, Motoaki; Satou, Masakazu; Iida, Kei; Akiyama, Kenji; Sakurai, Tetsuya; Fujita, Miki; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo
(Kawamura and Uemura 2003) composition of ...
... F3 Extracellular solute-binding  protein 
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Gómez-Sagasti, María T.; Becerril, José M.; Epelde, Lur; Alkorta, Itziar; Garbisu, Carlos
3 F: CGCTTGCAGTACCAGATCCC R: ...
... solubilization processes for isolating muscle  protein 
The Acid and Alkaline Solubilization Process for the Isolation of Muscle Proteins: State of the Art
The Acid and Alkaline Solubilization Process for the Isolation of Muscle Proteins: State of the Art
Nolsøe, Helgi; Undeland, Ingrid
from ground fish raw materials are ...
... transducing adapter molecule 1 ribosomal  protein 
Unscrambling butterfly oogenesis
Unscrambling butterfly oogenesis
Carter, Jean-Michel; Baker, Simon C; Pink, Ryan; Carter, David RF; Collins, Aiden; Tomlin, Jeremie; Gibbs, Melanie; Breuker, Casper J
LP2 PACG20471 nucleolar GTP-binding ...
... transcripts by interfering with any RNA–  protein 
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
Smith, Carrie A.; Robertson, Dominique; Yates, Bethan; Nielsen, Dahlia M.; Brown, Doug; Dean, Ralph A.; Payne, Gary A.
interactions, including mRNA splicing ...
... TNS order HNS order 1 JHP0952 hypothetical  protein 
Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
Saunders, Nigel J; Boonmee, Prawit; Peden, John F; Jarvis, Stephen A
HP0427 14 3 1355 2 JHP0476 cag pathogenicity ...
... splicing of many target genes. This  protein 
ICIEM Abstracts
ICIEM Abstracts
is a component of the spliceosome and has ...
... Results We have investigated how well the  protein 
Microarray analysis of orthologous genes: conservation of the translational machinery across species at the sequence and expression level
Microarray analysis of orthologous genes: conservation of the translational machinery across species at the sequence and expression level
Jiménez, Jose L; Mitchell, Michael P; Sgouros, John G
subcellular localization and functional ...
... proteins containing sequence and/or  protein 
Genome-wide subcellular localization of putative outer membrane and extracellular proteins in Leptospira interrogans serovar Lai genome using bioinformatics approaches
Genome-wide subcellular localization of putative outer membrane and extracellular proteins in Leptospira interrogans serovar Lai genome using bioinformatics approaches
Viratyosin, Wasna; Ingsriswang, Supawadee; Pacharawongsakda, Eakasit; Palittapongarnpim, Prasit
folding structures similar to those of known ...
... Nashville, TN A detailed understanding of  protein 
Abstract
Abstract
expression in breast cancer will require the ...
... by extracting functional information from  protein 
Bridging protein local structures and protein functions
Bridging protein local structures and protein functions
Liu, Zhi-Ping; Wu, Ling-Yun; Wang, Yong; Zhang, Xiang-Sun; Chen, Luonan
sequences, structures and interactions. ...
... In agreement with physiological and  protein 
Comparison of long-term up-regulated genes during induction of freezing tolerance by cold and ABA in bromegrass cell cultures revealed by microarray analyses
Comparison of long-term up-regulated genes during induction of freezing tolerance by cold and ABA in bromegrass cell cultures revealed by microarray analyses
Nakamura, Toshihide; Yazaki, Junshi; Kishimoto, Naoki; Kikuchi, Shoshi; Robertson, Albert J.; Gusta, Lawrence V.; Ishikawa, Masaya
studies, these two cold hardiness induction ...
... PCR targeting the 4b gene that encodes a core  protein 
Genomic characterization of two novel pathogenic avipoxviruses isolated from pacific shearwaters (Ardenna spp.)
Genomic characterization of two novel pathogenic avipoxviruses isolated from pacific shearwaters (Ardenna spp.)
Sarker, Subir; Das, Shubhagata; Lavers, Jennifer L.; Hutton, Ian; Helbig, Karla; Imbery, Jacob; Upton, Chris; Raidal, Shane R.
of ChPV, however, there were no evidence of ...
... Background  Protein 
No protein intake compensation for insufficient indispensable amino acid intake with a low-protein diet for 12 days
No protein intake compensation for insufficient indispensable amino acid intake with a low-protein diet for 12 days
Martens, Eveline A; Tan, Sze-Yen; Mattes, Richard D; Westerterp-Plantenga, Margriet S
quality evaluation aims to determine the ...
... there was a corresponding difference in  protein 
The CJIE1 prophage of Campylobacter jejuni affects protein expression in growth media with and without bile salts
The CJIE1 prophage of Campylobacter jejuni affects protein expression in growth media with and without bile salts
Clark, Clifford G; Chong, Patrick M; McCorrister, Stuart J; Simon, Philippe; Walker, Matthew; Lee, David M; Nguy, Kimberly; Cheng, Keding; Gilmour, Matthew W; Westmacott, Garrett R
expression levels. ...
... a number of biological products that include  protein 
Comparative pan genome analysis of oral Prevotella species implicated in periodontitis
Comparative pan genome analysis of oral Prevotella species implicated in periodontitis
Ibrahim, Maziya; Subramanian, Ahalyaa; Anishetty, Sharmila
toxins, lipopolysaccharide (endotoxin), ...
... and sustainable biomass for the production of  protein 
The protein content of seaweeds: a universal nitrogen-to-protein conversion factor of five
The protein content of seaweeds: a universal nitrogen-to-protein conversion factor of five
Angell, Alex R.; Mata, Leonardo; Nys, Rocky; Paul, Nicholas A.
has resulted in a renewed interest in the ...
... the continuous increase of R&D investment in  protein 
The stabilization of biopharmaceuticals: current understanding and future perspectives
The stabilization of biopharmaceuticals: current understanding and future perspectives
Song, Jae Geun; Lee, Sang Hoon; Han, Hyo-Kyung
-based drug products, thus the number of ...
... of haphazard hot/cold spots. CDX1 and CDX2  protein 
Oral Free Paper Sessions
Oral Free Paper Sessions
loss are independent biomarkers of worse ...