Snippet Search

Searching 12,181,313 documents.
Discover how a particular term or phrase is used in scientific literature

Showing 1 to 25 of 66667 matching articles

Results per page:

... abundances of many proteins participating in  protein 
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou
synthesis, including ribosomal proteins, ...
... F3 Extracellular solute-binding  protein 
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Gómez-Sagasti, María T.; Becerril, José M.; Epelde, Lur; Alkorta, Itziar; Garbisu, Carlos
3 F: CGCTTGCAGTACCAGATCCC R: ...
... attaining and maintaining muscle mass. From  protein 
Building Muscle Mass: Physiology, Nutrition, and Supplementation
Building Muscle Mass: Physiology, Nutrition, and Supplementation
Levers, Kyle; Vargo, Kelley
to creatine, arginine to human growth ...
... fertilizer or soil compost due to their high  protein 
Utilization of Oilseed Cakes for Human Nutrition and Health Benefits
Utilization of Oilseed Cakes for Human Nutrition and Health Benefits
Teh, Sue-Siang; Bekhit, Alaa El-Din A.
, carbohydrate, mineral and nitrogen ...
... The other was on a complement regulatory  protein 
GLYCO 23 XXIII International Symposium on Glycoconjugates
GLYCO 23 XXIII International Symposium on Glycoconjugates
, decay accelerating factor (DAF). ...
... Background  Protein 
The Effects of Protein Supplements on Muscle Mass, Strength, and Aerobic and Anaerobic Power in Healthy Adults: A Systematic Review
The Effects of Protein Supplements on Muscle Mass, Strength, and Aerobic and Anaerobic Power in Healthy Adults: A Systematic Review
Pasiakos, Stefan M.; McLellan, Tom M.; Lieberman, Harris R.
supplements are frequently consumed by ...
... have been found in nature. Here we used  protein 
Folding Mechanisms of Trefoil Knot Proteins Studied by Molecular Dynamics Simulations and Go-model
Folding Mechanisms of Trefoil Knot Proteins Studied by Molecular Dynamics Simulations and Go-model
Wu, Xue; Xu, Peijun; Wang, Jinguang; Xu, Yong; Fu, Ting; Zhang, Depeng; Zhao, Meixia; Liu, Jiahui; Shen, Hujun; Xiu, Zhilong; Li, Guohui
unfolding simulations under high temperature ...
... its sustainable utilization. Due to the high  protein 
Influence of Protein Extraction Techniques of Different De-oiled Residues from Jatropha curcas L. on Protein Recovery and Techno-functional Properties
Influence of Protein Extraction Techniques of Different De-oiled Residues from Jatropha curcas L. on Protein Recovery and Techno-functional Properties
Gofferjé, G.; Zöttl, A.; Stäbler, A.; Herfellner, T.; Schweiggert-Weisz, U.; Flöter, E.
content (up to 40 %) in Jatropha seed cakes, ...
... response to extracellular signals. Currently,  protein 
Technology of Wheat Cell-Free-Based Protein Array for Biochemical Analyses of Protein Kinases and Ubiquitin E3 Ligases
Technology of Wheat Cell-Free-Based Protein Array for Biochemical Analyses of Protein Kinases and Ubiquitin E3 Ligases
Takahashi, Hirotaka; Nemoto, Keiichirou; Abdelaziz, Ramadan; Uematsu, Atsushi; Sawasaki, Tatsuya
phosphorylation is considered as an important ...
... study compared two methods for extracting the  protein 
Extraction, Composition and Functional Properties of Pennycress (Thlaspi arvense L.) Press Cake Protein
Extraction, Composition and Functional Properties of Pennycress (Thlaspi arvense L.) Press Cake Protein
Hojilla-Evangelista, Mila P.; Selling, Gordon W.; Berhow, Mark A.; Evangelista, Roque L.
in pennycress (Thlaspi arvense L.) press cake ...
... interaction mechanisms leading to  protein 
Large-scale crystallization of proteins for purification and formulation
Large-scale crystallization of proteins for purification and formulation
Hekmat, Dariusch
crystallization. ...
... Background  Protein 
A novel method for identifying disease associated protein complexes based on functional similarity protein complex networks
A novel method for identifying disease associated protein complexes based on functional similarity protein complex networks
Le, Duc-Hau
complexes formed by non-covalent interaction ...
... Increasingly sophisticated  protein 
Pharmacokinetic and pharmacodynamic considerations for the next generation protein therapeutics
Pharmacokinetic and pharmacodynamic considerations for the next generation protein therapeutics
Shah, Dhaval K.
engineering efforts have been undertaken ...
... abundance and other properties. Although  protein 
Types and effects of protein variations
Types and effects of protein variations
Vihinen, Mauno
-coding exons cover just over 1 % of the ...
... Normal bovine milk contains about 3.5 %  protein 
Milk Proteins
Milk Proteins
Fox, P. F.; Uniacke-Lowe, T.; McSweeney, P. L. H.; O’Mahony, J. A.
. ...
... the simultaneous and high-throughput study of  protein 
Plant Proteomics: Technologies and Applications
Plant Proteomics: Technologies and Applications
Gupta, Deepti Bhushan; Shekhar, Shubhendu; Agrawal, Lalit
expression profiles in cells, tissues, organs ...
... by supplemental L-leucine or mixtures of whey  protein 
Use of Whey and Leucine on Muscle
Use of Whey and Leucine on Muscle
Lollo, Pablo Christiano Barboza; Amaya-Farfan, Jaime; Moura, Carolina Soares; Morato, Priscila Neder
plus L-leucine, no undisputed evidence exists ...
... the acute effects of different dietary  protein 
Effects of protein type and composition on postprandial markers of skeletal muscle anabolism, adipose tissue lipolysis, and hypothalamic gene expression
Effects of protein type and composition on postprandial markers of skeletal muscle anabolism, adipose tissue lipolysis, and hypothalamic gene expression
Mobley, Christopher Brooks; Fox, Carlton D; Ferguson, Brian S; Pascoe, Corrie A; Healy, James C; McAdam, Jeremy S; Lockwood, Christopher M; Roberts, Michael D
sources (0.19 g, dissolved in 1 ml of water) ...
... the discovery of small-molecule inhibitors of  protein 
Biophysical Methods for Identifying Fragment-Based Inhibitors of Protein-Protein Interactions
Biophysical Methods for Identifying Fragment-Based Inhibitors of Protein-Protein Interactions
Pfaff, Samuel J.; Chimenti, Michael S.; Kelly, Mark J. S.; Arkin, Michelle R.
- ...
... stress via antioxidant enzyme activities and  protein 
Quantitative proteomics analysis reveals that S-nitrosoglutathione reductase (GSNOR) and nitric oxide signaling enhance poplar defense against chilling stress
Quantitative proteomics analysis reveals that S-nitrosoglutathione reductase (GSNOR) and nitric oxide signaling enhance poplar defense against chilling stress
Cheng, Tielong; Chen, Jinhui; EF, Abd_Allah; Wang, Pengkai; Wang, Guangping; Hu, Xiangyang; Shi, Jisen
S -nitrosylation modification, NO signal is ...
... the entrance and the first way station in the  protein 
Cytoplasm: ER Stress
Cytoplasm: ER Stress
Howell, Stephen
secretory pathway in plant cells. ...
... proteins, which are designated the iron (Fe)  protein 
Nitrogenase and homologs
Nitrogenase and homologs
Hu, Yilin; Ribbe, Markus W.
and the molybdenum-iron (MoFe) ...
...  Protein 
Protein Requirements in Inherited Metabolic Diseases
Protein Requirements in Inherited Metabolic Diseases
Yannicelli, Steven
is a critical part of the diet in individuals ...
... In this chapter, an overview of  protein 
Protein Folding and Aggregation: A Revisit of Basic Conception
Protein Folding and Aggregation: A Revisit of Basic Conception
Qadeer, Atiyatul; Zaidi, Nida; Khan, Rizwan H.
folding and aggregation is given. ...
... fraction of world human population reveals  protein 
Proteopathies: Biological, Molecular and Clinical Perspectives
Proteopathies: Biological, Molecular and Clinical Perspectives
Chowhan, Rimpy K.; Dar, Tanveer Ali; Singh, Laishram R.
misfolding to be the common thread in all. ...