Snippet Search

Searching 11,460,015 documents.
Discover how a particular term or phrase is used in scientific literature

Showing 1 to 25 of 145 matching articles

Results per page:

... of the IPTG-inducible promoter, AAEC189(  pUC18 
Suppression subtractive hybridization identifies an autotransporter adhesin gene of E. coli IMT5155 specifically associated with avian pathogenic Escherichia coli (APEC)
Suppression subtractive hybridization identifies an autotransporter adhesin gene of E. coli IMT5155 specifically associated with avian pathogenic Escherichia coli (APEC)
Dai, Jianjun; Wang, Shaohui; Guerlebeck, Doreen; Laturnus, Claudia; Guenther, Sebastian; Shi, Zhenyu; Lu, Chengping; Ewers, Christa
:aatA+P) expressing aatA under the control of ...
... to keep the acidity constant at pH 6.0. Plasmid  pUC18 
Biological assays and noncovalent interactions of pyridine-2-carbaldehyde thiosemicarbazonecopper(II) drugs with [poly(dA–dT)]2, [poly(dG–dC)]2, and calf thymus DNA
Biological assays and noncovalent interactions of pyridine-2-carbaldehyde thiosemicarbazonecopper(II) drugs with [poly(dA–dT)]2, [poly(dG–dC)]2, and calf thymus DNA
Ruiz, Rebeca; García, Begoña; Garcia-Tojal, Javier; Busto, Natalia; Ibeas, Saturnino; Leal, José M.; Martins, Célia; Gaspar, Jorge; Borrás, Joaquín; Gil-García, Rubén; González-Álvarez, Marta
(0.25 μg μL−1, 750 μM in nucleotides) in TE ...
... vector harboring the gene X to be mutated:  pUC18 
Mutagen™: A Random Mutagenesis Method Providing a Complementary Diversity Generated by Human Error-Prone DNA Polymerases
Mutagen™: A Random Mutagenesis Method Providing a Complementary Diversity Generated by Human Error-Prone DNA Polymerases
Mondon, Philippe; Grand, David; Souyris, Nathalie; Emond, Stéphane; Bouayadi, Khalil; Kharrat, Hakim
-X (cloned into BamHI, EcoRI restriction ...
... respectively, and subcloned into the plasmid  pUC18 
Pyrroloquinoline quinone biosynthesis in Escherichia coli through expression of the Gluconobacter oxydans pqqABCDE gene cluster
Pyrroloquinoline quinone biosynthesis in Escherichia coli through expression of the Gluconobacter oxydans pqqABCDE gene cluster
Yang, Xue-Peng; Zhong, Gui-Fang; Lin, Jin-Ping; Mao, Duo-Bin; Wei, Dong-Zhi
between the EcoRI–PstI sites downstream of the ...
... sterile and fertile lines were cloned into the  pUC18 
An unedited 1.1 kb mitochondrial orfB gene transcript in the Wild Abortive Cytoplasmic Male Sterility (WA-CMS) system of Oryza sativa L. subsp. indica
An unedited 1.1 kb mitochondrial orfB gene transcript in the Wild Abortive Cytoplasmic Male Sterility (WA-CMS) system of Oryza sativa L. subsp. indica
Das, Srirupa; Sen, Supriya; Chakraborty, Anirban; Chakraborti, Papia; Maiti, Mrinal K; Basu, Asitava; Basu, Debabrata; Sen, Soumitra K
vector. ...
... 621H pGOX3, and E. coli cloning vector  pUC18 
Construction of a Novel Shuttle Vector for Use in Gluconobacter oxydans
Construction of a Novel Shuttle Vector for Use in Gluconobacter oxydans
Zhang, Lin; Lin, Jinping; Ma, Yushu; Wei, Dongzhi; Sun, Ming
. ...
... RNAP was established. The template plasmid is a  pUC18 
Application of Escherichia coli phage K1E DNA-dependent RNA polymerase for in vitro RNA synthesis and in vivo protein production in Bacillus megaterium
Application of Escherichia coli phage K1E DNA-dependent RNA polymerase for in vitro RNA synthesis and in vivo protein production in Bacillus megaterium
Stammen, Simon; Schuller, Franziska; Dietrich, Sylvia; Gamer, Martin; Biedendieck, Rebekka; Jahn, Dieter
derivative, which enables blue/white screening ...
... Plasmids pCC1FOS Cloning vector; Chlr Epicentre  pUC18 
Cloning and biochemical characterization of a novel lipolytic gene from activated sludge metagenome, and its gene product
Cloning and biochemical characterization of a novel lipolytic gene from activated sludge metagenome, and its gene product
JunGang, Li; KeGui, Zhang; WenJun, Han
Cloning vector; Apr Takara pET28a Expression ...
... purchased from the TIANGEN Company. The  pUC18 
Identification of a Novel Virulence-Related Gene in Streptococcus suis Type 2 Strains
Identification of a Novel Virulence-Related Gene in Streptococcus suis Type 2 Strains
Zhang, Hui; Fan, Hongjie; Lu, Chenping
vector was commercially purchased from TaKaRa ...
... A nos poly (A) sequence was subcloned into  pUC18 
Heterologous expression of taro cystatin protects transgenic tomato against Meloidogyne incognita infection by means of interfering sex determination and suppressing gall formation
Heterologous expression of taro cystatin protects transgenic tomato against Meloidogyne incognita infection by means of interfering sex determination and suppressing gall formation
Chan, Yuan-Li; Yang, Ai-Hwa; Chen, Jen-Tzu; Yeh, Kai-Wun; Chan, Ming-Tsair
as a SmaI and KpnI fragment to form ...
... motifs centered on TATA or TA × TA motifs, two  pUC18 
Target site selection by the mariner-like element, Mos1
Target site selection by the mariner-like element, Mos1
Crénès, Gwénaelle; Moundras, Corinne; Demattei, Marie-Véronique; Bigot, Yves; Petit, Agnès; Renault, Sylvaine
recombinant plasmids for a tract of 18 TAs were ...
... vectors pUC18Not Cloning vector, with the  pUC18 
Genetic Analysis of Gram-Negative Bacteria Using Mini Tn5 Transposons
Genetic Analysis of Gram-Negative Bacteria Using Mini Tn5 Transposons
Cebolla*, A.; Arévalo-Rodríguez, M.
multicloning site flanked by NotI sites ApR, ...
... SalI, and the digested fragment was ligated to  pUC18 
Simultaneous suppression of three genes related to brassinosteroid (BR) biosynthesis altered campesterol and BR contents, and led to a dwarf phenotype in Arabidopsis thaliana
Simultaneous suppression of three genes related to brassinosteroid (BR) biosynthesis altered campesterol and BR contents, and led to a dwarf phenotype in Arabidopsis thaliana
Chung, Ho Yong; Fujioka, Shozo; Choe, Sunghwa; Lee, Soyoun; Lee, Youn Hyung; Baek, Nam In; Chung, In Sik
, creating ...
... bla erm Pspac-purE’ lacZ lacI This study  pUC18 
Accumulation of gene-targeted Bacillus subtilis mutations that enhance fermentative inosine production
Accumulation of gene-targeted Bacillus subtilis mutations that enhance fermentative inosine production
Asahara, Takayuki; Mori, Yukiko; Zakataeva, Natalia P.; Livshits, Vitaliy A.; Yoshida, Ken-ichi; Matsuno, Kiyoshi
bla Yanisch-Perron et al. 1985 pKM240 bla deoD ...
... Janthinobacterium sp. 4239 was constructed in  pUC18 
Isolation, characterization and heterologous expression of a novel chitosanase from Janthinobacterium sp. strain 4239
Isolation, characterization and heterologous expression of a novel chitosanase from Janthinobacterium sp. strain 4239
Johnsen, Mads G; Hansen, Ole C; Stougaard, Peter
in E. coli and plated onto agar medium ...
... for the TOPO TA cloning kit. Subcloning into  pUC18 
Design of multiplex calibrant plasmids, their use in GMO detection and the limit of their applicability for quantitative purposes owing to competition effects
Design of multiplex calibrant plasmids, their use in GMO detection and the limit of their applicability for quantitative purposes owing to competition effects
Debode, Frédéric; Marien, Aline; Janssen, Eric; Berben, Gilbert
... vectors for the construction of mutants,  pUC18 
Protocols for the Characterization of Solvent Tolerant Microorganisms: Construction and Characterization of Mutants
Protocols for the Characterization of Solvent Tolerant Microorganisms: Construction and Characterization of Mutants
Duque, E.; de la Torre, J.; García, V.; Pini, C.; Rodríguez-Conde, S.; Godoy, P.; Henares-Molina, M. A.; Krell, T.; Daniels, C.; Ramos, J. L.; Segura, A.
(or derivatives) and pKNG101. ...
... (pSRQ10) Gonzalez and Kunka [12] Plasmids    pUC18 
Heterologous Processing and Export of the Bacteriocins Pediocin PA-1 and Lactococcin A in Lactococcus Lactis: A Study with Leader Exchange
Heterologous Processing and Export of the Bacteriocins Pediocin PA-1 and Lactococcin A in Lactococcus Lactis: A Study with Leader Exchange
Chikindas, M.; Emond, E.; Haandrikman, A. J.; Kok, J.; Leenhouts, K.; Pandian, S.; Venema, G.; Venema, K.
Ampr, cloning vector Yannisch-Perron et al. ...
... of its promoter (Pcit) (Sender et al. 2004)    pUC18 
A simple expression system for Lactococcus lactis and Enterococcus faecalis
A simple expression system for Lactococcus lactis and Enterococcus faecalis
Marelli, Belkis; Magni, Christian
E. coli cloning vector New England Biolabs ...
... (5ʹ-TAATACGACTCACTATAGGG-3ʹ) for binding to  pUC18 
Transposon Mutagenesis in Clostridium difficile
Transposon Mutagenesis in Clostridium difficile
Hussain, Haitham A.; Roberts, Adam P.; Whalan, Rachael; Mullany, Peter
. 2. Taq DNA polymerase (Promega). 3. ...
... sequence was amplified by PCR from plasmid  pUC18 
Higher accumulation of F1-V fusion recombinant protein in plants after induction of protein body formation
Higher accumulation of F1-V fusion recombinant protein in plants after induction of protein body formation
Alvarez, M. Lucrecia; Topal, Emel; Martin, Federico; Cardineau, Guy A.
:Zera® using primers 5′AGGTCGACATCATGAGGGTGTTG ...
... and inserted into the EcoRΙ–HindIII sites in  pUC18 
Engineered amadoriase II exhibiting expanded substrate range
Engineered amadoriase II exhibiting expanded substrate range
Zheng, Jing; Guan, Hong; Xu, Lihua; Yang, Rong; Lin, Zhanglin
vector (Takara, Dalian, China) to yield ...
... obtain 5.109–2.1010 transformants/μg of  pUC18 
Synthetic Antibody Libraries
Synthetic Antibody Libraries
Martineau, Pierre
plasmid. ...
... Growth of DH5α E. coli cells transformed with  pUC18 
Antioxidant and Cytotoxic Activities of Aphanes arvensis Extracts
Antioxidant and Cytotoxic Activities of Aphanes arvensis Extracts
Hamad, İsmail; Erol-Dayi, Özlem; Pekmez, Murat; Önay-Uçar, Evren; Arda, Nazlı
plasmid, alkaline lysis of bacteria, and ...
... cells can be verified using the kit-provided  pUC18 
Fine-Tuning Enzyme Activity Through Saturation Mutagenesis
Fine-Tuning Enzyme Activity Through Saturation Mutagenesis
Hogrefe, Holly H.
control plasmid. ...