Snippet Search

Searching 11,975,612 documents.
Discover how a particular term or phrase is used in scientific literature

Showing 41901 to 41925 of 43738 matching articles

Results per page:

... incidence within the tumour of mutations in the  p53 
The Value of Adjuvant Treatment in Young Women with Breast Cancer
The Value of Adjuvant Treatment in Young Women with Breast Cancer
Clive, Sally; Dixon, J. Michael
gene, a higher proliferation rate and a greater ...
... the natural defenses of cells, such as protein  p53 
Phytoecdysteroids: Phytochemistry and Pharmacological Activity
Phytoecdysteroids: Phytochemistry and Pharmacological Activity
Laekeman, Gert; Vlietinck, Arnold
, against the consequences of being exposed to ...
... splicing factor, TP53 tumor protein  p53 
Secondary Adult Acute Myeloid Leukemia: a Review of Our Evolving Understanding of a Complex Disease Process
Secondary Adult Acute Myeloid Leukemia: a Review of Our Evolving Understanding of a Complex Disease Process
Zeichner, Simon B.; Arellano, Martha L.
, FLT3 fms-related tyrosine kinase 3, RAS rat ...
... epidermal keratinocytes, JB6 C141 cells, is  p53 
Cinnamtannin B-1 from bay wood exhibits antiapoptotic effects in human platelets
Cinnamtannin B-1 from bay wood exhibits antiapoptotic effects in human platelets
Bouaziz, A.; Romera-Castillo, C.; Salido, S.; Linares-Palomino, P. J.; Altarejos, J.; Bartegi, A.; Rosado, J. A.; Salido, G. M.
-dependent and mediated through the Bcl-2, Bax, ...
... in the core GBM-associated pathways, including  p53 
Towards precision medicine-based therapies for glioblastoma: interrogating human disease genomics and mouse phenotypes
Towards precision medicine-based therapies for glioblastoma: interrogating human disease genomics and mouse phenotypes
Chen, Yang; Gao, Zhen; Wang, Bingcheng; Xu, Rong
, Rb, and receptor tyrosine kinase ...
... peptide [28], amyloid β-peptide [29] and stapled  p53 
Molecular dynamics simulations of pro-apoptotic BH3 peptide helices in aqueous medium: relationship between helix stability and their binding affinities to the anti-apoptotic protein Bcl-XL
Molecular dynamics simulations of pro-apoptotic BH3 peptide helices in aqueous medium: relationship between helix stability and their binding affinities to the anti-apoptotic protein Bcl-XL
Lama, Dilraj; Sankararamakrishnan, Ramasubbu
peptide analogs [30] in explicit solvent. ...
... von p27(kip 1), nicht jedoch Veränderungen am  p53 
Gestationsbedingte Trophoblasttumoren
Gestationsbedingte Trophoblasttumoren
Horn, Lars-Christian
-Tumorsuppressorgen eine Rolle in der malignen ...
... 1JNX) and its complexes with the tumor suppressor  p53 
High occurrence of BRCA1 intragenic rearrangements in hereditary breast and ovarian cancer syndrome in the Czech Republic
High occurrence of BRCA1 intragenic rearrangements in hereditary breast and ovarian cancer syndrome in the Czech Republic
Vasickova, Petra; Machackova, Eva; Lukesova, Miroslava; Damborsky, Jiri; Horky, Ondrej; Pavlu, Hana; Kuklova, Jitka; Kosinova, Veronika; Navratilova, Marie; Foretova, Lenka
[34] (PDB-ID 1KZY), with the phosphorylated bach1 ...
... to co-localize with Rb and suppress the E2F1 and  p53 
Effects of lovastatin on breast cancer cells: a proteo-metabonomic study
Effects of lovastatin on breast cancer cells: a proteo-metabonomic study
Klawitter, Jelena; Shokati, Touraj; Moll, Vanessa; Christians, Uwe; Klawitter, Jost
transcriptional activity [50], is another novel ...
... of biomedicine. Several TFs such as NF-κB, AP1,  p53 
Unveiling differentially expressed genes upon regulation of transcription factors in sepsis
Unveiling differentially expressed genes upon regulation of transcription factors in sepsis
Zhang, Junli; Cheng, Yuelei; Duan, Minmin; Qi, Nannan; Liu, Jian
, PPAR, CREB, STAT, and E2F were closely related ...
... NGF, BDNF, GDNF, sFAS, TNF-α receptor1 [p55],  p53 
Tyrosine hydroxylase (TH), its cofactor tetrahydrobiopterin (BH4), other catecholamine-related enzymes, and their human genes in relation to the drug and gene therapies of Parkinson’s disease (PD): historical overview and future prospects
Tyrosine hydroxylase (TH), its cofactor tetrahydrobiopterin (BH4), other catecholamine-related enzymes, and their human genes in relation to the drug and gene therapies of Parkinson’s disease (PD): historical overview and future prospects
Nagatsu, Toshiharu; Nagatsu, Ikuko
, interferon-γ, NF-κB, β2-MG [MHC1], Bcl-2, ...
... to contribute to cisplatin resistance in a Brca1/  p53 
Cancer Stem Cells: Potential Mediators of Therapeutic Resistance and Novel Targets of Anti-cancer Treatments
Cancer Stem Cells: Potential Mediators of Therapeutic Resistance and Novel Targets of Anti-cancer Treatments
Yan, Hong; Qin, Jichao; Tang, Dean G.
mutant mouse mammary tumor model [78]. ...
... and GFP reporter genes ii) HPV16-E7, murine  p53 
The Immunology of DNA Vaccines
The Immunology of DNA Vaccines
Tüting, Thomas; Austyn, Jonathan; Storkus, Walter J.; Falo, Louis D., Jr.
Cell: DC from murine bone marrow precursors ...
... changes (these genes include APC, K-RAS and  p53 
Phenotype transformation of immortalized NCM460 colon epithelial cell line by TGF-β1 is associated with chromosome instability
Phenotype transformation of immortalized NCM460 colon epithelial cell line by TGF-β1 is associated with chromosome instability
Huang, Chao; Wen, Bin
) and genomic instability deemed as the ...
... Alpha particles such as thorium dioxide cause  p53 
Hepatic and Perihepatic Involvement in Pneumokonioses and Other Mineral-Induced Diseases
Hepatic and Perihepatic Involvement in Pneumokonioses and Other Mineral-Induced Diseases
Zimmermann, Arthur
gene mutations (Hollstein et al. 1997; Iwamoto et ...
... factors, such as c-jun, ATF2, Elk-1,  p53 
Cisplatin induces expression of drug resistance-related genes through c-jun N-terminal kinase pathway in human lung cancer cells
Cisplatin induces expression of drug resistance-related genes through c-jun N-terminal kinase pathway in human lung cancer cells
Xu, Li; Fu, Yingya; Li, Youlun; Han, Xiaoli
and c-Myc [6, 7, 9, 10], and non-transcription ...
... with highly scattered DNA ploidy patterns and  p53 
MRP2 (ABCC2, cMOAT) expression in nuclear envelope of primary fallopian tube cancer cells is a new unfavorable prognostic factor
MRP2 (ABCC2, cMOAT) expression in nuclear envelope of primary fallopian tube cancer cells is a new unfavorable prognostic factor
Halon, Agnieszka; Materna, Verena; Donizy, Piotr; Matkowski, Rafal; Rabczynski, Jerzy; Lage, Hermann; Surowiak, Pawel
gene alterations are strongly connected with the ...
... transcripts involved in amino-sugar metabolism,  p53 
Sepsis and Organ(s) Dysfunction
Sepsis and Organ(s) Dysfunction
Gullo, A.; Celestre, C. M.; Paratore, A. L.; Silvestri, L.; van Saene, H. K.
-dependent cell-cycle arrest, β-adrenergic ...
... It has been demonstrated that Mn-SOD induces  p53 
Elemental fingerprinting of tumorous and adjacent non-tumorous tissues from patients with colorectal cancer using ICP-MS, ICP-OES and chemometric analysis
Elemental fingerprinting of tumorous and adjacent non-tumorous tissues from patients with colorectal cancer using ICP-MS, ICP-OES and chemometric analysis
Lavilla, Isela; Costas, Marta; Miguel, Pilar San; Millos, Jorge; Bendicho, Carlos
-dependent senescence in colorectal cancer cells ...
... Two tumour suppressor genes, retinoblastoma and  p53 
Molecular characterisation of breast cancer patients at high and low recurrence risk
Molecular characterisation of breast cancer patients at high and low recurrence risk
Bonin, Serena; Brunetti, Davide; Benedetti, Elena; Dotti, Isabella; Gorji, Nader; Stanta, Giorgio
, are central factors in replicative and ...
... receptor (HER2)). They also frequently carry  p53 
Methylation of the BRCA1 promoter in peripheral blood DNA is associated with triple-negative and medullary breast cancer
Methylation of the BRCA1 promoter in peripheral blood DNA is associated with triple-negative and medullary breast cancer
Gupta, Satish; Jaworska-Bieniek, Katarzyna; Narod, Steven A.; Lubinski, Jan; Wojdacz, Tomasz K.; Jakubowska, Anna
mutations [1–7]. ...
... work R - AACCCTACCCCAATGAAGTCC Tumour protein  p53 
Citrate gold nanoparticle exposure in the marine bivalve Ruditapes philippinarum: uptake, elimination and oxidative stress response
Citrate gold nanoparticle exposure in the marine bivalve Ruditapes philippinarum: uptake, elimination and oxidative stress response
Volland, Moritz; Hampel, Miriam; Martos-Sitcha, Juan A.; Trombini, Chiara; Martínez-Rodríguez, Gonzalo; Blasco, Julián
(TP53: ruditapes2_c752) Cell cycle and apoptosis ...
... Noh et al. recently reported that acetylated  P53 
Label-free quantitative proteomic analysis reveals potential biomarkers and pathways in renal cell carcinoma
Label-free quantitative proteomic analysis reveals potential biomarkers and pathways in renal cell carcinoma
Zhao, Zuohui; Wu, Fei; Ding, Sentai; Sun, Liang; Liu, Zhao; Ding, Kejia; Lu, Jiaju
indicated favorable prognosis in ccRCC [13]. ...
... caspase-3 and the apoptosis-related proteins  p53 
Cardiorenal Protection in Diabetes Mellitus
Cardiorenal Protection in Diabetes Mellitus
Vashistha, Himanshu; Meggs, Leonard G.; Malhotra, Ashwani
and Bax was found to be upregulated in hearts of ...
... antigen recognized by T cells (SART) 2, SART3,  p53 
Development of Immunotherapy for Hepatocellular Carcinoma
Development of Immunotherapy for Hepatocellular Carcinoma
Mizukoshi, Eishiro; Kaneko, Shuichi
, MRP3, AFP, and hTERT were frequently recognized ...

Subject

(see all 643)

Country

(see all 246)

Publication Type


Publisher